Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00021640
Genome
Helicobacter pylori - NC_000915.1
TF
Fur [UniProtKB:Q1CU85, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAGAAAAGATTTACCAAAAAGTATTAAAAAATGATTACAATAA - [399099, 399141] 19399190 Experimental technique details EMSA (ECO:0001807) - Experimental technique details RNAse protection (ECO:0000288) - Experimental technique details Visual sequence inspection (nan) - 701

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... HP0389 HP0388 HP0390
Gene Locus tag Description
HP0389 HP0389 iron-dependent superoxide dismutase
HP0388 HP0388 hypothetical protein
HP0390 HP0390 adhesin