Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00014ca0
Genome
Bradyrhizobium diazoefficiens - NC_004463.1
TF
Fur [UniProtKB:H7C6Q1, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GTTGCGAGAAACTTGCATCTGCATCTA - [823416, 823442] 20573962 Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details In-vitro transcription (ECO:0001204) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 688

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... irr fabA fabB fabI blr0772
Gene Locus tag Description
irr bll0768 iron response regulator
fabA blr0769 3-hydroxydecanoyl-ACP dehydratase
fabB blr0770 3-oxoacyl-ACP synthase
fabI blr0771 enoyl-(acyl carrier protein) reductase
blr0772 blr0772 blr0772