Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00014950
Genome
Escherichia coli - NC_007682.3
TF
LexA [UniProtKB:P0A7C2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GACTGTTTTTTTGTACAGTC + [8357, 8376] 21529368 Experimental technique details EMSA (ECO:0001807) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 665

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... intI1 ant3'9 linF
Gene Locus tag Description
intI1 pMUR050_006
ant3'9 pMUR050_007 aminoglycoside resistance protein
linF pMUR050_008 LinF