Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000129d0
Genome
Campylobacter jejuni - NC_002163.1
TF
CosR [UniProtKB:Q0PBF4, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATTCAGTTAATTTTAATTTTT + [1322456, 1322476] 23065977 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 646

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... katA Cj1384c Cj1383c fldA Cj1386
Gene Locus tag Description
katA Cj1385 catalase
Cj1384c Cj1384c hypothetical protein
Cj1383c Cj1383c hypothetical protein
fldA Cj1382c flavodoxin FldA
Cj1386 Cj1386 ankyrin-repeat containing protein