Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000128b0
Genome
Sinorhizobium meliloti - NC_003047.1
TF
Mur [UniProtKB:Q92LL6, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TGCAAATGCTTCTCATTTGCA + [3283851, 3283871] 17557847 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - 644

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... fur sitA sitB sitC sitD
Gene Locus tag Description
fur SMc02510 ferric uptake regulation protein
sitA SMc02509 iron-binding periplasmic ABC transporter protein
sitB SMc02508 iron transport ATP-binding ABC transporter protein
sitC SMc02507 iron transport system membrane ABC transporter protein
sitD SMc02506 iron transport system membrane ABC transporter protein