Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000127d0
Genome
Xanthomonas campestris - NC_007086.1
TF
HrpX [UniProtKB:Q8PBF5, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTCGCGCGTTTCGCAATTGCC + [1584205, 1584225] 22865058 Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details GUS reporter gene assay (ECO:0005641) - 639

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... XC_1296
Gene Locus tag Description
XC_1296 XC_1296 proline imino-peptidase