Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000127c0
Genome
Xanthomonas oryzae - NC_007705.1
TF
HrpX [UniProtKB:Q9ZIP8, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTCGCCAAATCGCACATCGATTCTG + [4303434, 4303458] 15774873 Experimental technique details GUS reporter gene assay (ECO:0005641) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 638

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... XOO_3803 XOO_3802
Gene Locus tag Description
XOO_3803 XOO_3803 hypothetical protein
XOO_3802 XOO_3802 magnesium and cobalt transport protein