Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000f620
Genome
Xanthomonas campestris - NC_007086.1
TF
Clp [UniProtKB:Q4UZF6, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AACGGTGCGCTTCACCGCACCC - [4241631, 4241652] 18175178 Experimental technique details EMSA (ECO:0001807) - Experimental technique details GUS reporter gene assay (ECO:0005641) - Experimental technique details PSSM site search (ECO:0005659) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - 628

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... XC_3573 XC_3575
Gene Locus tag Description
XC_3573 XC_3573 general secretion pathway protein E
XC_3575 XC_3575 protease