Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000f610
Genome
Xanthomonas axonopodis - NC_020800.1
TF
OxyR [UniProtKB:M4U7P6, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATCATGTTCCCCTATCGAAGCGATCATAACTAACGAC - [4700028, 4700064] 15699208 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Northern blot (ECO:0005653) - Experimental technique details Visual sequence inspection (nan) - 625

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... XAC29_20300 XAC29_20305 XAC29_20295
Gene Locus tag Description
XAC29_20300 XAC29_20300 catalase
XAC29_20305 XAC29_20305 catalase
XAC29_20295 XAC29_20295 ankyrin-like protein