Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000f160
Genome
Enterobacteria phage P22 - NC_002371.2
TF
Arc [UniProtKB:A8CG91, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATGATAGAAGCACTCTACTAT + [14798, 14818] 2914951 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Premethylation interference footprinting (ECO:0005656) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 620

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... mnt orf59a ant arc
Gene Locus tag Description
mnt P22gp15 Mnt
orf59a P22gp16 hypothetical protein
ant P22gp17 Ant
arc P22gp18 Arc