Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000efe0
Genome
Xanthomonas campestris - NC_007086.1
TF
HpaR1 [UniProtKB:Q8PAI3, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GTTGAATACAAAACCAGTCATCCAAC + [3287516, 3287541] 21615202 Experimental technique details EMSA (ECO:0001807) - Experimental technique details GUS reporter gene assay (ECO:0005641) - Experimental technique details In-vitro transcription (ECO:0001204) - Experimental technique details Visual sequence inspection (nan) - 606

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... XC_2736 XC_2735 XC_2737 XC_2738 XC_2739 XC_2740 XC_2741
Gene Locus tag Description
XC_2736 XC_2736 GntR family transcriptional regulator
XC_2735 XC_2735 ABC transporter vitamin B12 uptake permease
XC_2737 XC_2737 ABC transporter ATP-binding protein
XC_2738 XC_2738 hypothetical protein
XC_2739 XC_2739 hypothetical protein
XC_2740 XC_2740 hypothetical protein
XC_2741 XC_2741 hypothetical protein