Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000d120
Genome
Xanthomonas campestris - NC_003902.1
TF
Clp [UniProtKB:Q4UZF6, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTCTGTGGGGACGATCACACCA + [4194936, 4194957] 15955530 Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Site directed mutagenesis (ECO:0005667) - Experimental technique details Visual sequence inspection (nan) - 599

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... engXCA ybaR
Gene Locus tag Description
engXCA XCC3521 cellulase
ybaR XCC3520 sulfate permease