Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000d080
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
Vfr [UniProtKB:P55222, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTTTTTGCGGCAGATGGCATTT - [5924442, 5924463] 17159200 Experimental technique details EMSA (ECO:0001807) - Experimental technique details PSSM site search (ECO:0005659) - 594

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... algZ algR hemC hemD PA5258 PA5257 argH
Gene Locus tag Description
algZ PA5262 alginate biosynthesis protein AlgZ/FimS
algR PA5261 alginate biosynthesis regulatory protein AlgR
hemC PA5260 porphobilinogen deaminase
hemD PA5259 uroporphyrinogen-III synthase
PA5258 PA5258 hypothetical protein
PA5257 PA5257 hypothetical protein
argH PA5263 argininosuccinate lyase