Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000d040
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
ExsA [UniProtKB:P26993, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TAAAAAAACCACGGCCAATCCTGATAG + [58702, 58728] 18373522 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - 592

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PA0043 exoT
Gene Locus tag Description
PA0043 PA0043 hypothetical protein
exoT PA0044 exoenzyme T