Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000d030
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
ExsA [UniProtKB:P26993, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CTAAAAATAACTGACGTTTTTTGAAAG + [1858096, 1858122] 18373522 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - 592

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... exsA exsD pscB pscC pscD pscE pscF pscG pscH pscI pscJ pscK pscL
Gene Locus tag Description
exsA PA1713 transcriptional regulator ExsA
exsD PA1714 ExsD
pscB PA1715 type III export apparatus protein
pscC PA1716 type III secretion outer membrane protein PscC precursor
pscD PA1717 type III export protein PscD
pscE PA1718 type III export protein PscE
pscF PA1719 type III export protein PscF
pscG PA1720 type III export protein PscG
pscH PA1721 type III export protein PscH
pscI PA1722 type III export protein PscI
pscJ PA1723 type III export protein PscJ
pscK PA1724 type III export protein PscK
pscL PA1725 type III secretion system protein