Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000d020
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
ExsA [UniProtKB:P26993, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CTTAAAAGAAAAGTCTCTCAGTGACAA + [1855783, 1855809] 18373522 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - 592

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... exsC exsE exsB
Gene Locus tag Description
exsC PA1710 exoenzyme S synthesis protein C
exsE PA1711 ExsE
exsB PA1712 exoenzyme S synthesis protein B