Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000cf40
Genome
Streptococcus uberis - NC_012004.1
TF
HdiR [UniProtKB:B9DUC0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTAGTAAAGTTATAACTTTACTAAA + [880313, 880337] 17513475 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Northern blot (ECO:0005653) - Experimental technique details Visual sequence inspection (nan) - 586

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... SUB0899 SUB0898 SUB0897 SUB0896 SUB0900 SUB0901 SUB0903
Gene Locus tag Description
SUB0899 SUB0899 phage repressor-like protein
SUB0898 SUB0898 impB/mucB/samB family
SUB0897 SUB0897 hypothetical protein
SUB0896 SUB0896 hypothetical protein
SUB0900 SUB0900 oxidoreductase
SUB0901 SUB0901 hypothetical protein
SUB0903 SUB0903 2,5-diketo-D-gluconic acid reductase