Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000ce60
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
CueR [UniProtKB:Q9HV30, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GGGTTGACCTTGCCAAGGTGTCAAGGTCGATAAC - [3943869, 3943902] 20233934 Experimental technique details Beta-gal reporter assay - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details PSSM site search (ECO:0005659) - 577

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PA3523 PA3522 PA3521 gloA1
Gene Locus tag Description
PA3523 PA3523 Resistance-Nodulation-cell Division (RND) efflux membrane fusion protein
PA3522 PA3522 Resistance-Nodulation-cell Division (RND) efflux transporter
PA3521 PA3521 hypothetical protein
gloA1 PA3524 lactoylglutathione lyase