Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000cdd0
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
IscR [UniProtKB:Q9HXI7, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAACCCGAGGTTTTCGCTCGGGTAAA - [2860361, 2860386] 22609922 Experimental technique details EMSA (ECO:0001807) - Experimental technique details Northern blot (ECO:0005653) - Experimental technique details Visual sequence inspection (nan) - 571

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... tpx
Gene Locus tag Description
tpx PA2532 thiol peroxidase