Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000cdc0
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
MexT [UniProtKB:Q9I0Z0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATCAGCCCTGTCGATAGCGACTAT + [4881948, 4881971] 19846594 Experimental technique details Beta-gal reporter assay - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - 570

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PA4354 PA4353 PA4352 PA4355 xenB
Gene Locus tag Description
PA4354 PA4354 hypothetical protein
PA4353 PA4353 hypothetical protein
PA4352 PA4352 hypothetical protein
PA4355 PA4355 major facilitator superfamily (MFS) transporter
xenB PA4356 xenobiotic reductase