Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000cda0
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
MexT [UniProtKB:Q9I0Z0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATCAACCTTATCGATAAGTACCAT - [3119787, 3119810] 19846594 Experimental technique details Beta-gal reporter assay - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - 570

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PA2759 PA2760 PA2761
Gene Locus tag Description
PA2759 PA2759 hypothetical protein
PA2760 PA2760 hypothetical protein
PA2761 PA2761 hypothetical protein