Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000cd90
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
MexT [UniProtKB:Q9I0Z0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATCATTTCTGTCGATAGTTAATAG - [1887620, 1887643] 19846594 Experimental technique details Beta-gal reporter assay - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - 570

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PA1744 PA1743
Gene Locus tag Description
PA1744 PA1744 hypothetical protein
PA1743 PA1743 hypothetical protein