Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000cd70
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
MexT [UniProtKB:Q9I0Z0, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATCACCCATGTCGATAGACACTAT + [5477649, 5477672] 19846594 Experimental technique details Beta-gal reporter assay - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 568

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... PA4881
Gene Locus tag Description
PA4881 PA4881 hypothetical protein