Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000cb70
Genome
Bacillus subtilis - NC_000964.3
TF
Zur [UniProtKB:P54479, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAATCGTAACAATTACGTTTT + [365797, 365817] 18344368 Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 552

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... yciC yciB yciA nasA yczL yckA yckB
Gene Locus tag Description
yciC BSU03360 metallochaperone with NTPase activity
yciB BSU03350 metal uptake system lipoprotein
yciA BSU03340 GTP cyclohydrolase
nasA BSU03330 nitrate transporter
yczL BSU03359 hypothetical protein
yckA BSU03370 ABC transporter permease
yckB BSU03380 ABC transporter binding lipoprotein