Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000cb10
Genome
Caulobacter vibrioides - NC_011916.1
TF
Fur [UniProtKB:A0A0H3C2M1, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATTGCAATTCGTTCTCAAGTAAG + [3311236, 3311258] 23941329 Experimental technique details Beta-gal reporter assay - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Motif-discovery (ECO:0005558) - 549

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... CCNA_03155 CCNA_03154 CCNA_03153 CCNA_03152 CCNA_03156 CCNA_03157 CCNA_03158 CCNA_03159 CCNA_03160 CCNA_03161
Gene Locus tag Description
CCNA_03155 CCNA_03155 transporter
CCNA_03154 CCNA_03154 PAS-family sensor histidine kinase/receiver protein
CCNA_03153 CCNA_03153 hypothetical protein
CCNA_03152 CCNA_03152 hypothetical protein
CCNA_03156 CCNA_03156 hypothetical protein
CCNA_03157 CCNA_03157 hypothetical protein
CCNA_03158 CCNA_03158 iron-sulfur cluster assembly/repair protein ApbE
CCNA_03159 CCNA_03159 sulfite reductase (NADPH) flavoprotein subunit alpha
CCNA_03160 CCNA_03160 molybdopterin-guanine dinucleotide biosynthesis protein A
CCNA_03161 CCNA_03161 transcriptional regulator xylR