Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000c890
Genome
Salmonella enterica - NC_016856.1
TF
PmrA [UniProtKB:Q8Z1P4, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TACACCATTACTTAATATTATCTTAATTTT - [1486797, 1486826] 23690578 Experimental technique details Beta-gal reporter assay - Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Site directed mutagenesis (ECO:0005667) - 528

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ssrB ssrA STM14_1685 orf242 ssaB ssaC ssaD ssaE STM14_1692 STM14_1693 STM14_1694 sscA sseC sseD sseE sscB sseF sseG ssaG ssaH ssaI ssaJ STM14_1706 ssaK ssaL ssaM ssaV ssaN ssaO ssaP ssaQ ssaR ssaS ssaT ssaU STM14_1719 valW valV
Gene Locus tag Description
ssrB STM14_1686 transcriptional activator
ssrA STM14_1687 sensor kinase
STM14_1685 STM14_1685 hypothetical protein
orf242 STM14_1684 putative regulatory protein
ssaB STM14_1688 secreted effector protein
ssaC STM14_1689 outer membrane secretin precursor
ssaD STM14_1690 virulence protein
ssaE STM14_1691 secretion system effector
STM14_1692 STM14_1692 hypothetical protein
STM14_1693 STM14_1693 secretion system chaperone protein
STM14_1694 STM14_1694 translocation machinery component
sscA STM14_1695 secretion system chaperone
sseC STM14_1696 translocation machinery component
sseD STM14_1697 translocation machinery component
sseE STM14_1698 secreted effector protein
sscB STM14_1699 secretion system chaperone
sseF STM14_1700 secreted effector protein
sseG STM14_1701 secreted effector protein
ssaG STM14_1702 type III secretion system apparatus protein
ssaH STM14_1703 type III secretion system apparatus protein
ssaI STM14_1704 type III secretion system apparatus protein
ssaJ STM14_1705 needle complex inner membrane lipoprotein
STM14_1706 STM14_1706 putative cytoplasmic protein
ssaK STM14_1707 type III secretion system apparatus protein
ssaL STM14_1708 type III secretion system apparatus protein
ssaM STM14_1709 type III secretion system apparatus protein
ssaV STM14_1710 secretion system apparatus protein SsaV
ssaN STM14_1711 type III secretion system ATPase
ssaO STM14_1712 type III secretion system apparatus protein
ssaP STM14_1713 type III secretion system apparatus protein
ssaQ STM14_1714 type III secretion system protein
ssaR STM14_1715 type III secretion system protein
ssaS STM14_1716 type III secretion system apparatus protein
ssaT STM14_1717 type III secretion system apparatus protein
ssaU STM14_1718 secretion system apparatus protein SsaU
STM14_1719 STM14_1719 hypothetical protein
valW STM14_1720 tRNA
valV STM14_1721 tRNA