Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000bbd0
Genome
Vibrio parahaemolyticus - NC_004605.1
TF
AphA [UniProtKB:Q87L53, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CAATGTAACAAGTGGCATAT + [200435, 200454] 22984476 Experimental technique details Beta-gal reporter assay - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Primer Extension assay (ECO:0005657) - 508

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VPA0199 VPA0198 VPA0197 VPA0196 VPA0195 VPA0200
Gene Locus tag Description
VPA0199 VPA0199 hemolysin secretion protein HylB
VPA0198 VPA0198 GGDEF family protein
VPA0197 VPA0197 hypothetical protein
VPA0196 VPA0196 hypothetical protein
VPA0195 VPA0195 NupC family protein
VPA0200 VPA0200 hypothetical protein