Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000097f0
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
LasR [UniProtKB:P25084, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATCTATCTCATTTGCTAGTT + [1559179, 1559198] 15505212 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - 475

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... rsaL lasR lasI PA1433 PA1434
Gene Locus tag Description
rsaL PA1431 regulatory protein RsaL
lasR PA1430 transcriptional regulator LasR
lasI PA1432 autoinducer synthesis protein LasI
PA1433 PA1433 hypothetical protein
PA1434 PA1434 hypothetical protein