| Binding site | Location | Publication | Experimental techniques used | Curation |
|---|---|---|---|---|
| CCGCCGTATACTGTATACACTT | - [1076352, 1076373] | 19939938 |
|
457 |
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Gene | Locus tag | Description |
|---|---|---|
| fumB | GSU0994 | fumarate hydratase |
| GSU0993 | GSU0993 | acyl-CoA thioesterase |
| GSU0992 | GSU0992 | hypothetical protein |
| GSU0991 | GSU0991 | ExpC-like family glycosyltransferase |
| GSU0990 | GSU0990 | hypothetical protein |
| GSU0989 | GSU0989 | NHL repeat domain-containing protein |
| GSU0988 | GSU0988 | hypothetical protein |
| GSU0987 | GSU0987 | hypothetical protein |
| GSU0986 | GSU0986 | phage baseplate outer wedge protein (acidic lysozyme) |
| GSU0985 | GSU0985 | PAAR motif-containing protein |
| GSU0996 | GSU0996 | SAP domain-containing protein |
| mutM | GSU0997 | formamidopyrimidine-DNA glycosylase |
| dnaB | GSU0998 | replicative DNA helicase |
| lpxA-2 | GSU0999 | UDP-N-acetylglucosamine acyltransferase |
| GSU1000 | GSU1000 | hypothetical protein |