Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00009490
Genome
Geobacter sulfurreducens - NC_002939.5
TF
HgtR [UniProtKB:Q747A3, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CTTTTGTATACTGTATACAAAC + [1606340, 1606361] 19939938 Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details Primer Extension assay (ECO:0005657) - 457

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... icd GSU1464 aspS mdh
Gene Locus tag Description
icd GSU1465 isocitrate dehydrogenase
GSU1464 GSU1464 lysM domain-containing protein
aspS GSU1463 aspartyl-tRNA ligase
mdh GSU1466 malate dehydrogenase