Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00008720
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
LasR [UniProtKB:P54292, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TCCTGTGAAATCTGGCAGTT - [3893269, 3893288] 14526008 Experimental technique details Beta-gal reporter assay - Experimental technique details Consensus search (ECO:0005624) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Visual sequence inspection (nan) - 419

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... rhlA rhlB rhlR PA3480 PA3481 metG PA3483 PA3484 PA3485
Gene Locus tag Description
rhlA PA3479 rhamnosyltransferase chain A
rhlB PA3478 rhamnosyltransferase chain B
rhlR PA3477 transcriptional regulator RhlR
PA3480 PA3480 deoxycytidine triphosphate deaminase
PA3481 PA3481 hypothetical protein
metG PA3482 methionyl-tRNA synthetase
PA3483 PA3483 hypothetical protein
PA3484 PA3484 hypothetical protein
PA3485 PA3485 hypothetical protein