Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00007960
Genome
Escherichia coli - NC_000913.2
TF
PhoP [UniProtKB:P23836, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GCTGGTTGAGCATTTGTTGAAAA + [849381, 849403] 15703297 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Machine learning prediction (ECO:0005649) - Experimental technique details PSSM site search (ECO:0005659) - 394

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ompX mntS yliL ybiP rhtA ybiS ybiR mntR rybA
Gene Locus tag Description
ompX b0814 outer membrane protein X
mntS b4705 Mn(2)-response protein, MntR-repressed
yliL b0816 predicted protein
ybiP b0815 predicted hydrolase, inner membrane
rhtA b0813 threonine and homoserine efflux system
ybiS b0819 L,D-transpeptidase linking Lpp to murein
ybiR b0818 predicted transporter
mntR b0817 DNA-binding transcriptional regulator of mntH
rybA b4416 ncRNA