Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000078d0
Genome
Escherichia coli - NC_000913.2
TF
PhoP [UniProtKB:P23836, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CATTGTTTAGGGTTTGTTTAATT - [578166, 578188] 15703297 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Machine learning prediction (ECO:0005649) - Experimental technique details PSSM site search (ECO:0005659) - 393

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ybcV essD rrrD rzpD rzoD borD
Gene Locus tag Description
ybcV b0558 DLP12 prophage; predicted protein
essD b0554 DLP12 prophage; predicted phage lysis protein
rrrD b0555 DLP12 prophage; predicted lysozyme
rzpD b0556 DLP12 prophage; predicted murein endopeptidase
rzoD b4510 DLP12 prophage; predicted lipoprotein
borD b0557 DLP12 prophage; predicted lipoprotein