Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000078b0
Genome
Escherichia coli - NC_000913.2
TF
PhoP [UniProtKB:P23836, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CATTGTTTAGGTTTTGTTTAAGT + [3346404, 3346426] 15703297 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Machine learning prediction (ECO:0005649) - Experimental technique details PSSM site search (ECO:0005659) - 393

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... yrbL yhcC arcB arcZ elbB mtgA yrbG kdsD kdsC lptC lptA lptB rpoN hpf ptsN yhbJ npr
Gene Locus tag Description
yrbL b3207 predicted protein
yhcC b3211 predicted Fe-S oxidoreductase
arcB b3210 aerobic respiration control sensor histidine protein kinase, cognate to two-component response regulators ArcA and RssB
arcZ b4450 ncRNA
elbB b3209 isoprenoid biosynthesis protein with amidotransferase-like domain
mtgA b3208 biosynthetic peptidoglycan transglycosylase
yrbG b3196 predicted calcium/sodium:proton antiporter
kdsD b3197 D-arabinose 5-phosphate isomerase
kdsC b3198 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase
lptC b3199 lipopolysaccharide export, IM-tethered periplasmic protein of the LptBFGC export complex
lptA b3200 periplasmic LPS-binding protein
lptB b3201 lipopolysaccharide export ABC transporter ATP-binding protein of the LptBFGC export complex
rpoN b3202 RNA polymerase, sigma 54 (sigma N) factor
hpf b3203 ribosome hibernation promoting factor HPF; stabilizes 70S dimers (100S)
ptsN b3204 sugar-specific enzyme IIA component of PTS
yhbJ b3205 glmZ(sRNA)-inactivating NTPase, glucosamine-6-phosphate regulated
npr b3206 phosphohistidinoprotein-hexose phosphotransferase component of N-regulated PTS system (Npr)