Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000078a0
Genome
Escherichia coli - NC_000913.2
TF
PhoP [UniProtKB:P23836, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CAGTTTTTAAAAACTGTTTAAAG + [2288280, 2288302] 15703297 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Machine learning prediction (ECO:0005649) - Experimental technique details PSSM site search (ECO:0005659) - 393

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... insH yejM proL yejO narP yejL
Gene Locus tag Description
insH b2192 IS5 transposase and trans-activator
yejM b2188 predicted hydrolase, inner membrane
proL b2189 tRNA
yejO b2190 pseudo
narP b2193 DNA-binding response regulator in two-component regulatory system with NarQ or NarX
yejL b2187 conserved protein, UPF0352 family