Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00007880
Genome
Escherichia coli - NC_000913.2
TF
PhoP [UniProtKB:P23836, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GCTGGTTTATTTAATGTTTACCC - [1189728, 1189750] 15703297 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Machine learning prediction (ECO:0005649) - Experimental technique details PSSM site search (ECO:0005659) - 393

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... phoP rluE nudJ mnmA hflD purB pepT ycfD phoQ
Gene Locus tag Description
phoP b1130 DNA-binding response regulator in two-component regulatory system with PhoQ
rluE b1135 23S rRNA U2457 pseudouridine synthase
nudJ b1134 bifunctional thiamin pyrimidine pyrophosphate hydrolase/ thiamin pyrophosphate hydrolase
mnmA b1133 tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase
hflD b1132 predicted lysogenization regulator
purB b1131 adenylosuccinate lyase
pepT b1127 peptidase T
ycfD b1128 cupin superfamily protein
phoQ b1129 sensory histidine kinase in two-component regulatory system with PhoP