Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00007870
Genome
Escherichia coli - NC_000913.2
TF
PhoP [UniProtKB:P23836, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TCTGGTTTATCGTTGGTTTAGTT + [4465341, 4465363] 15703297 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Machine learning prediction (ECO:0005649) - Experimental technique details PSSM site search (ECO:0005659) - 393

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... mgtA mgtL treC treB treR
Gene Locus tag Description
mgtA b4242 magnesium transporter
mgtL b4702 regulatory leader peptide for mgtA
treC b4239 trehalose-6-P hydrolase
treB b4240 fused trehalose(maltose)-specific PTS enzyme: IIB component/IIC component
treR b4241 DNA-binding transcriptional repressor