Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00007840
Genome
Escherichia coli - NC_000913.2
TF
PhoP [UniProtKB:P23836, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TGCCGTTGATAAAGAGTTTATCT - [2371609, 2371631] 15703297 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Machine learning prediction (ECO:0005649) - Experimental technique details PSSM site search (ECO:0005659) - 393

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... pmrD rbn elaA elaB menF menD menH menB menC menE arnB arnC arnA arnD arnT arnE arnF
Gene Locus tag Description
pmrD b2259 inactive two-component system connector protein
rbn b2268 RNase BN, tRNA processing enzyme
elaA b2267 predicted acyltransferase with acyl-CoA N-acyltransferase domain
elaB b2266 conserved protein
menF b2265 isochorismate synthase 2
menD b2264 bifunctional 2-oxoglutarate decarboxylase/ SHCHC synthase
menH b2263 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase
menB b2262 dihydroxynaphthoic acid synthetase
menC b2261 o-succinylbenzoyl-CoA synthase
menE b2260 o-succinylbenzoate-CoA ligase
arnB b2253 uridine 5'-(beta-1-threo-pentapyranosyl-4-ulose diphosphate) aminotransferase, PLP-dependent
arnC b2254 undecaprenyl phosphate-L-Ara4FN transferase
arnA b2255 fused UDP-L-Ara4N formyltransferase/UDP-GlcA C-4'-decarboxylase
arnD b2256 Undecaprenyl phosphate-alpha-L-ara4FN deformylase
arnT b2257 4-amino-4-deoxy-L-arabinose transferase
arnE b4544 undecaprenyl phosphate-alpha-L-ara4N exporter; flippase ArnEF subunit
arnF b2258 undecaprenyl phosphate-alpha-L-ara4N exporter; flippase ArnEF subunit