Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000077f0
Genome
Escherichia coli - NC_000913.2
TF
PhoP [UniProtKB:P23836, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AGATATATAACGTCGGTTTATAA + [2969230, 2969252] 15703297 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Machine learning prediction (ECO:0005649) - Experimental technique details PSSM site search (ECO:0005659) - 393

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ygdR omrB omrA aas lplT tas mutH ygdQ
Gene Locus tag Description
ygdR b2833 novel lipoprotein
omrB b4445 ncRNA
omrA b4444 ncRNA
aas b2836 fused 2-acylglycerophospho-ethanolamine acyl transferase/acyl-acyl carrier protein synthetase
lplT b2835 lysophospholipid transporter
tas b2834 predicted oxidoreductase, NADP(H)-dependent aldo-keto reductase; suppresses tyrosine requirement of tyrA14 O6 strain
mutH b2831 methyl-directed mismatch repair protein
ygdQ b2832 inner membrane protein, UPF0053 family