Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000077c0
Genome
Escherichia coli - NC_000913.2
TF
PhoP [UniProtKB:P23836, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ACATAGTTAGGCGCTGTTTAACT - [1906838, 1906860] 15703297 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Machine learning prediction (ECO:0005649) - Experimental technique details PSSM site search (ECO:0005659) - 393

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... yebO mgrB kdgR yobH
Gene Locus tag Description
yebO b1825 predicted inner membrane protein
mgrB b1826 regulatory peptide for PhoPQ, feedback inhibition
kdgR b1827 DNA-binding transcriptional regulator f kdgK, kdgT, eda
yobH b4536 predicted protein