Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000077b0
Genome
Escherichia coli - NC_000913.2
TF
PhoP [UniProtKB:P23836, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TGGTATTCACGAAAAGTTTATGT - [1717667, 1717689] 15703297 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Machine learning prediction (ECO:0005649) - Experimental technique details PSSM site search (ECO:0005659) - 393

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... slyB slyA dtpA gstA pdxY tyrS pdxH mliC anmK
Gene Locus tag Description
slyB b1641 outer membrane lipoprotein
slyA b1642 DNA-binding transcriptional activator
dtpA b1634 dipeptide and tripeptide permease A
gstA b1635 glutathionine S-transferase
pdxY b1636 pyridoxamine kinase
tyrS b1637 tyrosyl-tRNA synthetase
pdxH b1638 pyridoxine 5'-phosphate oxidase
mliC b1639 inhibitor of c-type lysozyme, membrane-bound; predicted lipoprotein
anmK b1640 anhydro-N-acetylmuramic acid kinase