Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000077a0
Genome
Escherichia coli - NC_000913.2
TF
PhoP [UniProtKB:P23836, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTATAAACATAAGCTATACGCTG - [3662821, 3662843] 15703297 Experimental technique details Beta-gal reporter assay - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Machine learning prediction (ECO:0005649) - Experimental technique details PSSM site search (ECO:0005659) - 392

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... gadY gadX gadW
Gene Locus tag Description
gadY b4452 ncRNA
gadX b3516 DNA-binding transcriptional dual regulator
gadW b3515 transcriptional activator of gadA and gadBC in absence of GadX