Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00007790
Genome
Escherichia coli - NC_000913.2
TF
PhoP [UniProtKB:P23836, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CCATCAACATGACATATACAGAA - [3654835, 3654857] 15703297 Experimental technique details Beta-gal reporter assay - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Machine learning prediction (ECO:0005649) - Experimental technique details PSSM site search (ECO:0005659) - 392

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... hdeA hdeD dctR yhiD hdeB
Gene Locus tag Description
hdeA b3510 stress response protein acid-resistance protein
hdeD b3511 acid-resistance membrane protein
dctR b3507 predicted DNA-binding ranscriptional regulator
yhiD b3508 predicted Mg(2+) transport ATPase, inner membrane protein
hdeB b3509 acid-resistance protein