Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00006080
Genome
Escherichia coli - NC_000913.2
TF
Fur [UniProtKB:P0A9A9, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CGTCGAATTGATAGTCGTTCTCATTACTATT + [3150061, 3150091] 17921503 Experimental technique details EMSA (ECO:0001807) - Experimental technique details PSSM site search (ECO:0005659) - 357

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... dkgA yqhD yqhC yghB metC exbD exbB
Gene Locus tag Description
dkgA b3012 2,5-diketo-D-gluconate reductase A
yqhD b3011 aldehyde reductase, NADPH-dependent
yqhC b3010 transcriptional activator of yqhD
yghB b3009 required, with yqjA, for membrane integrity; inner membrane protein
metC b3008 cystathionine beta-lyase, PLP-dependent
exbD b3005 membrane spanning protein in TonB-ExbB-ExbD complex
exbB b3006 membrane spanning protein in TonB-ExbB-ExbD complex