Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00006020
Genome
Escherichia coli - NC_000913.2
TF
Fur [UniProtKB:P0A9A9, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CATGATAATGAAATTAATTATCGTTATCGAT + [621422, 621452] 17921503 Experimental technique details EMSA (ECO:0001807) - Experimental technique details PSSM site search (ECO:0005659) - 357

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... fepC fepG fepD fepB entS fepE
Gene Locus tag Description
fepC b0588 iron-enterobactin transporter subunit
fepG b0589 iron-enterobactin transporter subunit
fepD b0590 iron-enterobactin transporter subunit
fepB b0592 iron-enterobactin transporter subunit
entS b0591 enterobactin exporter, iron-regulated
fepE b0587 regulator of length of O-antigen component of lipopolysaccharide chains