Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00005a20
Genome
Listeria monocytogenes - NC_003210.1
TF
LexA [UniProtKB:Q8Y7H7, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTTAAGAACGTTTGTTCGTAT - [2916121, 2916141] 19892760 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - 338

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... lmo2828 lmo2829
Gene Locus tag Description
lmo2828 lmo2828 lmo2828
lmo2829 lmo2829 similar to yeast protein Frm2p involved in fatty acid signaling