Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00005a00
Genome
Listeria monocytogenes - NC_003210.1
TF
LexA [UniProtKB:Q8Y7H7, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AATGCGAAAATATGTTCGGTT - [2567589, 2567609] 19892760 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - 338

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... uvrB uvrA lmo2490 lmo2491 lmo2492
Gene Locus tag Description
uvrB lmo2489 excinuclease ABC subunit B
uvrA lmo2488 excinuclease ABC subunit A
lmo2490 lmo2490 similar to B. subtilis CsbA protein
lmo2491 lmo2491 lmo2491
lmo2492 lmo2492 lmo2492