Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000059f0
Genome
Listeria monocytogenes - NC_003210.1
TF
LexA [UniProtKB:Q8Y7H7, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAAAAGAACGTATGTGCGAAA + [2400976, 2400996] 19892760 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - 338

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... int lmo2331 lmo2330 lmo02333
Gene Locus tag Description
int lmo2332 integrase
lmo2331 lmo2331 weakly similar to gp32_Bacteriophage A118 protein
lmo2330 lmo2330 similar to protein gp33 [Bacteriophage A118]
lmo02333 lmo02333 pseudo