Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000059d0
Genome
Listeria monocytogenes - NC_003210.1
TF
LexA [UniProtKB:Q8Y7H7, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AATAAAAACATATGTTCGGTG - [2359807, 2359827] 19892760 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - 338

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... addB lmo2267 lmo2266 lmo2265 lmo2269
Gene Locus tag Description
addB lmo2268 similar to ATP-dependent deoxyribonuclease (subunit B)
lmo2267 lmo2267 similar to ATP-dependent deoxyribonuclease (subunit A)
lmo2266 lmo2266 hypothetical protein
lmo2265 lmo2265 hypothetical protein
lmo2269 lmo2269 lmo2269