Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000059c0
Genome
Listeria monocytogenes - NC_003210.1
TF
LexA [UniProtKB:Q8Y7H7, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AATAAGAACGTATATTCGGTT - [2312716, 2312736] 19892760 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - 338

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... lmo2222 lmo2221 lmo2220 lmo2219 lmo2223
Gene Locus tag Description
lmo2222 lmo2222 hypothetical protein
lmo2221 lmo2221 hypothetical protein
lmo2220 lmo2220 similar to S. aureus Cbf1 protein
lmo2219 lmo2219 similar to post-translocation molecular chaperone
lmo2223 lmo2223 hypothetical protein